Molekuler Karakterisasi Bakteri Asam Laktat Isolate Dadih Air Dingin Kabupaten Solok Sumatera Barat

Purwati, Dkk., Endang
Journal article Jurnal Penelitian Inovasi • Februari 2014 Indonesia

Unduh teks lengkap
(Bahasa Indonesia, 13 pages)

Abstrak

Penelitian ini tentang isolasi, karakterisasi dan identifikasi DNA BAL dadih daerah Air Dingin telah dilakukan dengan hasil menunjukkan bahwa total koloni bakteri asam laktat yaitu 1.46x108 CFU/g. Kadar lemak dadih 3.5418% diukur dengan metoda sokletasi dan kadar protein dadih 4.565% diukur dengan metoda Kjeldahl. Dari hasil isolasi bakteri asam laktat didapatkan sebelas (11) isolat yaitu R2, R3, R4, R5, R6, R7, R8, R9, R11, R12, R14. Karakter koloni dari sebelas isolat ini berbentuk bundar, permukaan cembung, berwarna putih susu dan merupakan bakteri Gram positif dengan sebelas isolat berbentuk sel batang. Uji katalase dan uji oksidase menunjukkan bahwa semua isolat negatif katalase dan negatif oksidase. Metode yang digunakan adalah 16S rRNA dengan primer P. Forward (27F ; AGAGTTTGATCCTGGCTGAG), P. Reverse (1492R; GTTTACCTTACGACTT) memberikan hasil elektroforesis DNA BAL pada 11 Isolate berukuran 1500 kb dan dilanjutkan dengan menggunakan BLAST dan CLUSTER memberi hasil Lactobacillus plantarum. Kata Kunci : dadih, susu kerbau, bakteri asam laktat, Lactobacillus plantarum.

Metrik

  • 591 kali dilihat
  • 353 kali diunduh

Jurnal

Jurnal Penelitian Inovasi

Jurnal Penelitian Inovasi is an open access, peer-reviewed journal that publishes original resear... tampilkan semua